zgc:158869

Ensembl ID:
ENSDARG00000069440
ZFIN ID:
ZDB-GENE-070112-152
Description:
dachshund homolog 1 [Source:RefSeq peptide;Acc:NP_001074142]
Human Orthologue:
DACH1
Human Description:
dachshund homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:2663]
Mouse Orthologue:
Dach1
Mouse Description:
dachshund 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1277991]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9313 Nonsense Mutation detected in F1 DNA During 2018
sa44705 Essential Splice Site Mutation detected in F1 DNA During 2018
sa15020 Nonsense Available for shipment Available now
sa7192 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9313
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101070 Nonsense 29 611 1 11

The following transcripts of ENSDARG00000069440 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 31924133)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 31080079
GRCz11 9 30890825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGGTCCATCCGTGTCCGATCTCAACTTCTTCGTCAGCATCATCAGCAT[C/A]ATCATCATCATGCTCCGCGACCGCAGCATCATCATCCTCGCCCTCGGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101070 Essential Splice Site 190 611 1 11

The following transcripts of ENSDARG00000069440 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 31924617)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 31080563
GRCz11 9 30891309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCCAGAAAAGACTTCGAGACCCTCTACAACGACTGCACCAATGCCAG[G/A]TTAGAACAAACTCTTTTACCTTTCCACAACAGGCAATCGATAGCTAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15020
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101070 Nonsense 366 611 5 11

The following transcripts of ENSDARG00000069440 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 32049054)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 31205000
GRCz11 9 31015746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCCCCTCTCTGGAAGAYGGCAGGAGGCCGGGGAGCCGTCCCTYGTCC[C/T]AGCGCAGCAGCAGCGTCYCYAGCTCTCCAGCACAYACCGAGAGCTCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101070 Nonsense 564 611 9 11

The following transcripts of ENSDARG00000069440 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 32085787)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 31241733
GRCz11 9 31052479
KASP Assay ID:
554-4503.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTGGAATATGAGTCGAAGCGACGAGAGCAGGCGGAGCAGACCCTGAAA[C/T]AGACATCACCTACAGAAAGTCTCAGATCACTYAATGGTGAGACATTTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link