zgc:194505

Ensembl ID:
ENSDARG00000069439
ZFIN ID:
ZDB-GENE-081022-118
Description:
LOC555483 protein [Source:UniProtKB/TrEMBL;Acc:B3DI79]
Human Orthologues:
LCN15, LCNL1
Human Descriptions:
lipocalin 15 [Source:HGNC Symbol;Acc:33777]
lipocalin-like 1 [Source:HGNC Symbol;Acc:34436]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16004 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16004
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101077 Essential Splice Site 137 190 4 6
ENSDART00000139143 Essential Splice Site 137 186 4 7
Genomic Location (Zv9):
Chromosome 10 (position 10759437)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10835303
GRCz11 10 10793541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCAAACACAAGAAGATGAACAAGGAATACACACAAGTGTCCCTTTATG[G/A]TGAGACTGTAATAAATACCATRGWGCACCACTATGGAGCATCACACTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link