zgc:153620

Ensembl ID:
ENSDARG00000069435
ZFIN ID:
ZDB-GENE-060929-128
Description:
Novel protein (Zgc:153620) [Source:UniProtKB/TrEMBL;Acc:B8JHX6]
Human Orthologue:
CCDC147
Human Description:
coiled-coil domain containing 147 [Source:HGNC Symbol;Acc:26676]
Mouse Orthologue:
Ccdc147
Mouse Description:
coiled-coil domain containing 147 Gene [Source:MGI Symbol;Acc:MGI:2685815]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19575 Nonsense Available for shipment Available now
sa11728 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101066 Nonsense 231 885 5 18
ENSDART00000110335 Nonsense 231 838 5 17
Genomic Location (Zv9):
Chromosome 1 (position 48337771)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 47149432
GRCz11 1 47840664
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGGGAGACCAGGAGGAAGGAGAAGTTGGAAAAGGAAGTGAAGCAGTTT[C/T]AAACTGACCTGGAGTCCAAACAATCAGAGATTAAATTACTGACTCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101066 Nonsense 481 885 10 18
ENSDART00000110335 Nonsense 481 838 10 17
Genomic Location (Zv9):
Chromosome 1 (position 48377337)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 47188998
GRCz11 1 47880230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYATTAAACTGAAGGAGATGCAGATATTTGAATAYAAGAAGAGGATCGCA[G/T]AAGCTGAAACCAAACTGAAGCAGCAGCAGAATCTCTATGAGGACGTCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link