zgc:77051

Ensembl ID:
ENSDARG00000069432
ZFIN IDs:
ZDB-GENE-040426-2517, ZDB-GENE-040426-2517
Description:
phospholipid scramblase 1 [Source:RefSeq peptide;Acc:NP_998031]
Human Orthologue:
PLSCR3
Human Description:
phospholipid scramblase 3 [Source:HGNC Symbol;Acc:16495]
Mouse Orthologue:
Plscr3
Mouse Description:
phospholipid scramblase 3 Gene [Source:MGI Symbol;Acc:MGI:1917560]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34074 Nonsense Available for shipment Available now
sa34073 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34074
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099003 Nonsense 101 314 4 8
ENSDART00000101057 Nonsense 101 314 5 9
Genomic Location (Zv9):
Chromosome 7 (position 27717193)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26320132
GRCz11 7 26591325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAGTCCTCAATGTTGTTACTAGTATTTTCTTTACATTTCAGATTGAC[C/T]AGATCCTTATTCATCAGAAAGTGGAGTTGTTGGAGGGTGAGTTATTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099003 Essential Splice Site 295 314 7 8
ENSDART00000101057 Essential Splice Site 295 314 8 9
Genomic Location (Zv9):
Chromosome 7 (position 27710678)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26313617
GRCz11 7 26584810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGGATGTTAAGATGAAGGCTGTACTTATGGGAACTTGCTTTCTTATC[G/T]TGAGTATTGAGCTAATGGTACAATTAATTATCCATACCATAGATCAGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link