slc26a4

Ensembl ID:
ENSDARG00000069431
ZFIN ID:
ZDB-GENE-060503-544
Description:
pendrin [Source:RefSeq peptide;Acc:NP_001159387]
Human Orthologue:
SLC26A4
Human Description:
solute carrier family 26, member 4 [Source:HGNC Symbol;Acc:8818]
Mouse Orthologue:
Slc26a4
Mouse Description:
solute carrier family 26, member 4 Gene [Source:MGI Symbol;Acc:MGI:1346029]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20257 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20257
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101052 Essential Splice Site 266 760 7 20
ENSDART00000122976 Essential Splice Site 254 748 6 21
ENSDART00000146450 Essential Splice Site 253 744 6 18
Genomic Location (Zv9):
Chromosome 4 (position 17853877)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18796717
GRCz11 4 18785693
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTAATAATTATTAATTAGTTTTATTTCTTATTTCTTTTCTATATAT[A/T]GACTCTCATTGATGTAGGCAGTAACATCAACCAAGCAAACATGGCAGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link