zgc:158856

Ensembl ID:
ENSDARG00000069428
ZFIN ID:
ZDB-GENE-070112-1722
Description:
hypothetical protein LOC558918 [Source:RefSeq peptide;Acc:NP_001073645]
Human Orthologue:
SLBP
Human Description:
stem-loop binding protein [Source:HGNC Symbol;Acc:10904]
Mouse Orthologue:
Slbp
Mouse Description:
stem-loop binding protein Gene [Source:MGI Symbol;Acc:MGI:108402]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39336 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43668 Nonsense Mutation detected in F1 DNA During 2018
sa25162 Nonsense Mutation detected in F1 DNA During 2018
sa39335 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101051 Essential Splice Site 17 326 1 8

The following transcripts of ENSDARG00000069428 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29037178)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30256422
GRCz11 21 30293117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACAACACGCATAGAAAGCCTTCTTCAAAGCCCCTTTGAGTCGCGGTT[G/A]TATGTTTCAAAGCTTGTTTTGTGCCTTTAAAGTGTCCTCATGTGTTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43668
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101051 Nonsense 135 326 5 8

The following transcripts of ENSDARG00000069428 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29035897)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30255141
GRCz11 21 30291836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATCCCCATAATGCTGACCCTTCTCATTTTGAGATCAATGAGGCTGTTT[T/A]GAAGCGTAGGCAAAAGCAGATTCAGTATGGGAAGAATACCTGTGGCTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101051 Nonsense 157 326 5 8

The following transcripts of ENSDARG00000069428 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29035832)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30255076
GRCz11 21 30291771
KASP Assay ID:
554-7319.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGATTCAGTATGGGAAGAATACCTGTGGCTACCAGAACTACGTTCAG[C/T]AGGTTCCGAAGTGAGTTGTGGTGAACGTAAATATCCAACTATTAGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39335
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101051 Nonsense 294 326 8 8

The following transcripts of ENSDARG00000069428 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29033121)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30252365
GRCz11 21 30289060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCTCTCAGCATGGACTGGGCTATACCTTCAGCAATCAACAGACAGCA[C/T]AGGAAAACGTCCTGGGATGGTTGCGGTTTTTGCTTGAAACTGACCACAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link