si:dkey-72g4.1

Ensembl ID:
ENSDARG00000069427
ZFIN ID:
ZDB-GENE-041014-77
Description:
Novel protein similar to human T-cell lymphoma breakpoint associated target 1 (TCBA1) [Source:UniPro
Human Orthologue:
NKAIN2
Human Description:
Na+/K+ transporting ATPase interacting 2 [Source:HGNC Symbol;Acc:16443]
Mouse Orthologues:
Nkain2, Nkain2
Mouse Descriptions:
Na+/K+ transporting ATPase interacting 2 Gene [Source:MGI Symbol;Acc:MGI:1923447]
Na+/K+ transporting ATPase interacting 2 Gene [Source:MGI Symbol;Acc:MGI:1923447]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37124 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090938   None 155 None 5
ENSDART00000124633 Essential Splice Site 18 208 1 7
ENSDART00000140500   None 155 None 4
ENSDART00000145592 Essential Splice Site 18 158 1 4
Genomic Location (Zv9):
Chromosome 20 (position 40145137)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40216399
GRCz11 20 40119035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTGCAGTGGCAGATGTACGCTGGCGTTTATATGTGGCATGCAATTGG[T/A]AAGTGATTATGCTTTAAGTGATTTATTCTTAACCTGCGATGAACTCGTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link