zgc:153463

Ensembl ID:
ENSDARG00000069420
ZFIN ID:
ZDB-GENE-060929-804
Description:
GTP-binding protein ARD-1 [Source:RefSeq peptide;Acc:NP_001070112]
Human Orthologue:
TRIM23
Human Description:
tripartite motif-containing 23 [Source:HGNC Symbol;Acc:660]
Mouse Orthologue:
Trim23
Mouse Description:
tripartite motif-containing 23 Gene [Source:MGI Symbol;Acc:MGI:1933161]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15670 Nonsense Available for shipment Available now
sa21681 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15670
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101032   None 423 2 12
ENSDART00000127581 Nonsense 64 576 2 11
Genomic Location (Zv9):
Chromosome 10 (position 11805073)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11880939
GRCz11 10 11839177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCACGACTGCTGCTGTGTGGACACACGGTGTGTCACGACTGCTTGACA[C/T]GACTGCCTCTCCAYGGCAGGGCAGTACGCTGCCCCTTTGATAGACAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21681
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101032 Essential Splice Site 242 423 8 12
ENSDART00000127581 Essential Splice Site 395 576 7 11
Genomic Location (Zv9):
Chromosome 10 (position 11774968)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11850834
GRCz11 10 11809072
KASP Assay ID:
2260-2986.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCGATCACATTCAGCTGGATGCAGGCATCCCTGTTACTTTCACTAAGG[T/C]ACTGTTAATCATATAGATCATTGTTGAGAGAAAAAGAAATGCATGTTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link