
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:153463
- Ensembl ID:
- ENSDARG00000069420
- ZFIN ID:
- ZDB-GENE-060929-804
- Description:
- GTP-binding protein ARD-1 [Source:RefSeq peptide;Acc:NP_001070112]
- Human Orthologue:
- TRIM23
- Human Description:
- tripartite motif-containing 23 [Source:HGNC Symbol;Acc:660]
- Mouse Orthologue:
- Trim23
- Mouse Description:
- tripartite motif-containing 23 Gene [Source:MGI Symbol;Acc:MGI:1933161]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15670 | Nonsense | Available for shipment | Available now |
sa21681 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15670
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000101032 | None | 423 | 2 | 12 | |
ENSDART00000127581 | Nonsense | 64 | 576 | 2 | 11 |
- Genomic Location (Zv9):
- Chromosome 10 (position 11805073)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 11880939 GRCz11 10 11839177 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TACCACGACTGCTGCTGTGTGGACACACGGTGTGTCACGACTGCTTGACA[C/T]GACTGCCTCTCCAYGGCAGGGCAGTACGCTGCCCCTTTGATAGACAGGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21681
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000101032 | Essential Splice Site | 242 | 423 | 8 | 12 |
ENSDART00000127581 | Essential Splice Site | 395 | 576 | 7 | 11 |
- Genomic Location (Zv9):
- Chromosome 10 (position 11774968)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 11850834 GRCz11 10 11809072 - KASP Assay ID:
- 2260-2986.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCCGATCACATTCAGCTGGATGCAGGCATCCCTGTTACTTTCACTAAGG[T/C]ACTGTTAATCATATAGATCATTGTTGAGAGAAAAAGAAATGCATGTTACT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: