col17a1a
- Ensembl ID:
- ENSDARG00000069415
- ZFIN ID:
- ZDB-GENE-090313-107
- Description:
- collagen, type XVII, alpha 1a [Source:RefSeq peptide;Acc:NP_001139037]
- Human Orthologue:
- COL17A1
- Human Description:
- collagen, type XVII, alpha 1 [Source:HGNC Symbol;Acc:2194]
- Mouse Orthologue:
- Col17a1
- Mouse Description:
- collagen, type XVII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88450]
Alleles
There are 8 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa7401 |
Missense |
Mutation detected in F1 DNA |
During 2018 |
sa32763 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa19578 |
Essential Splice Site |
Available for shipment |
Available now |
sa16045 |
Essential Splice Site |
Available for shipment |
Available now |
sa19579 |
Nonsense |
Available for shipment |
Available now |
sa652 |
Nonsense |
F2 line generated |
During 2018 |
sa19580 |
Essential Splice Site |
Available for shipment |
Available now |
sa39682 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa7401
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Missense
- Genomic Location (Zv9):
- Chromosome 1 (position 50087290)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
48936471 |
GRCz11 |
1 |
49580891 |
- KASP Assay ID:
- 554-4244.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ACTTGNNNTTTTTTTTTGTTTATTTGCAGTTTCCACTAGCAGTGCTGCCA[C/T]CAGAGGGCGCACTCAAACACGAGGTATTTATCATTTAAAACCTACTAAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32763
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000101004 |
Essential Splice Site |
271 |
1191 |
None |
45 |
ENSDART00000142957 |
Essential Splice Site |
380 |
1408 |
None |
52 |
- Genomic Location (Zv9):
- Chromosome 1 (position 50090331)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
48939512 |
GRCz11 |
1 |
49583932 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCATGCAAAACAATCTGACCCTCAGTTCATCTGCCCTTGATACTACAGG[T/C]TATTACATTGAGCAGTTCACACAACAACACACTAAAATACATGAAATATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19578
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000101004 |
|
None |
1191 |
None |
45 |
ENSDART00000142957 |
Essential Splice Site |
403 |
1408 |
12 |
52 |
- Genomic Location (Zv9):
- Chromosome 1 (position 50090488)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
48939669 |
GRCz11 |
1 |
49584089 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCTACATCTGGCGGTGCTATGATGGCTAATGGAAGGTGCACTGGCTATG[G/A]TAAACTCAATCTTATCTCACTTCAATACTGTGCTTATTTTAAATGTTAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16045
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000101004 |
|
None |
1191 |
None |
45 |
ENSDART00000142957 |
Essential Splice Site |
404 |
1408 |
12 |
52 |
- Genomic Location (Zv9):
- Chromosome 1 (position 50090489)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
48939670 |
GRCz11 |
1 |
49584090 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TCYACATCTGGCGGTGCTATGATGGCTAATGGAAGGTGCACTGGCTATGG[T/A]AAACTCARTCTTATCTCACTTCAATACTNNNNGTGCTTATTTTAAATGTTAAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19579
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 1 (position 50093947)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
48943128 |
GRCz11 |
1 |
49587548 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGAGGCTGAAGGCTCGTGTGGATGCTATCGATGGTGGAGGAACCTCTCCT[C/T]GAACCAGCGGTTTGAAAACTGACGACATTCCTGGGGTCCAATCTGGTAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa652
- Current Status:
-
F2 line generated
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 1 (position 50094685)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
48943866 |
GRCz11 |
1 |
49588286 |
- KASP Assay ID:
- 554-0560.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TAGTTAACATTTATTTACAATTCAATATTTGTTATGATTTATTATAGCAT[C/A]GCTGGCAACTTCGCTCAGGGGAGAGAGAGGAGAACCTGGACCTAAAGGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19580
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000101004 |
Essential Splice Site |
669 |
1191 |
22 |
45 |
ENSDART00000142957 |
Essential Splice Site |
782 |
1408 |
26 |
52 |
- Genomic Location (Zv9):
- Chromosome 1 (position 50100753)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
48949934 |
GRCz11 |
1 |
49594354 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTTTTTCTTTTAGGTGATAAAGGACCTGCTGGGCCACCTGGGGTCAAAG[G/A]TCTGTAGATATCAGAGAAACGCATTGACAAAACTACTGCAGTTTACATGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39682
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 1 (position 50111534)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
48960715 |
GRCz11 |
1 |
49605135 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGCATTAGTTTATTTACAAAGTAGTGTTTCTACAGAAAATCATATGAAA[G/T]GACAAAAAGGCGACCTGGGATTTCCAGGAATTCCAGGTACAACTTTTACC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: