zgc:172049

Ensembl ID:
ENSDARG00000069409
ZFIN ID:
ZDB-GENE-080204-36
Description:
hypothetical protein LOC569254 [Source:RefSeq peptide;Acc:NP_001107088]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11570 Essential Splice Site Available for shipment Available now
sa22631 Essential Splice Site Available for shipment Available now
sa22632 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101000 Essential Splice Site None 494 3 23
Genomic Location (Zv9):
Chromosome 15 (position 20225065)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21327691
GRCz11 15 21263423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGRTGTTTTCCATGCAAACTAATGCAACAGAATTTTGAWCCTCTCTTAC[A/G]GTCGTCAGCTCTTCAGTGAAGTCTATCTCGTGACAAATGCTGACAAGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22631
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101000 Essential Splice Site None 494 4 23
Genomic Location (Zv9):
Chromosome 15 (position 20226492)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21329118
GRCz11 15 21264850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGAGTTGGCCATCCGAAGCCGACAGCTACAAGATGACATTATGGTGG[T/G]AAGAAATCACTTGTGCTTTTTCAGATAATATCTTCCATGTGGTGAGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22632
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101000 Essential Splice Site 270 494 14 23
Genomic Location (Zv9):
Chromosome 15 (position 20231180)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21333806
GRCz11 15 21269538
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATGTACTACATTTCTTTTATCACCTCTAGGGATTAGCTGGCAGTAGG[T/C]AAGTACAACATTAAATACACCAATGAACATTAACAATCAGGTTCTTTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link