si:dkeyp-114g9.1

Ensembl ID:
ENSDARG00000069401
ZFIN ID:
ZDB-GENE-030131-5466
Description:
hypothetical protein LOC555399 [Source:RefSeq peptide;Acc:NP_001037797]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29436 Nonsense Mutation detected in F1 DNA During 2018
sa11088 Nonsense Available for shipment Available now
sa39302 Nonsense Mutation detected in F1 DNA During 2018
sa37129 Nonsense Mutation detected in F1 DNA During 2018
sa17018 Nonsense Available for shipment Available now
sa37128 Nonsense Mutation detected in F1 DNA During 2018
sa17559 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29436
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100967 Nonsense 157 529 2 8
Genomic Location (Zv9):
Chromosome 20 (position 42022543)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42093702
GRCz11 20 41990812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCAGGAGAAGCTCTTCTTAGAGATCCCTCAAGCGCCGCATAAATACT[G/A]GATCCAGTGGCTGGTTCTGGAGGAGAGCGTCCCACTTCCCTCCGTCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11088
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100967 Nonsense 271 529 4 8
Genomic Location (Zv9):
Chromosome 20 (position 42011725)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42082884
GRCz11 20 41979994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGCTCTTCACATACTGGTTGTTTCGCCAGCCCACTCCATACAACAAG[C/T]AGCTGCGCTCTATTTTCCTACAGTGGAAGAAGCACAGCAAGAGAAAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100967 Nonsense 314 529 4 8
Genomic Location (Zv9):
Chromosome 20 (position 42011596)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42082755
GRCz11 20 41979865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGTATCTGGCCTCCCTGCATCCCATCACCAAAGACTACTGGAGAGGA[C/T]GATTGGCTCGGGGAGATGAGAGTCTGGGTGAGTTGTCTGCTGAAAATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100967 Nonsense 368 529 6 8
Genomic Location (Zv9):
Chromosome 20 (position 42007868)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42079027
GRCz11 20 41976137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGCCAGGTTTATGAAGACACGCTGGAGGGAGTGTATCTTCTGCTCAGG[C/T]GAGAGATGCAGGAGACTCTGATCGAGCACGAGCGCTTCTGGCAGGTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17018
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100967 Nonsense 413 529 6 8
Genomic Location (Zv9):
Chromosome 20 (position 42007731)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42078890
GRCz11 20 41976000
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACYGCAGCAAACTRCGTCAACTGGAAGATGATCGAGACGCTCCCTTACTA[C/A]AAGTCAGTACTCATTCATCTGATATAACAACACTATCTCACATCAATTST
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37128
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100967 Nonsense 416 529 7 8
Genomic Location (Zv9):
Chromosome 20 (position 42004726)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42075885
GRCz11 20 41972995
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCGAATACATTTAATGGTATTTTACCTCCTTTCTTTTTAAGGCTGTA[T/A]CTGGTGTCTGGAAATTCTGTGTACCTGGATCATGTGCAAGGTTTCTTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17559
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100967 Nonsense 512 529 8 8
Genomic Location (Zv9):
Chromosome 20 (position 41999540)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42070699
GRCz11 20 41967809
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTATCTGGAGGAGCTGAAGGCTATGGTGCTGCACTGTGCTCGGGTCTG[T/A]CTCGGGCAGATCTCAGTCAGCTGGAACTCWGCAGACTCACCACACACACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link