
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:113421
- Ensembl ID:
- ENSDARG00000069397
- ZFIN ID:
- ZDB-GENE-050320-59
- Description:
- hypothetical protein LOC100148379 [Source:RefSeq peptide;Acc:NP_001139179]
- Human Orthologue:
- KIAA0913
- Human Description:
- KIAA0913 [Source:HGNC Symbol;Acc:23528]
- Mouse Orthologue:
- 2310021P13Rik
- Mouse Description:
- RIKEN cDNA 2310021P13 gene Gene [Source:MGI Symbol;Acc:MGI:1919156]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13957 | Splice Site, Nonsense | Available for shipment | Available now |
sa31922 | Nonsense | Available for shipment | Available now |
sa11173 | Nonsense | Available for shipment | Available now |
sa28097 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa7226 | Essential Splice Site, Splice Site | Mutation detected in F1 DNA | During 2018 |
sa22278 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa13957
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056432 | Splice Site, Nonsense | 371 | 1912 | 8 | 26 |
ENSDART00000133108 | None | 196 | None | 4 | |
ENSDART00000144612 | None | 207 | None | 2 |
The following transcripts of ENSDARG00000069397 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 21992380)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 21721718 GRCz11 13 21852168 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACGCTGCACCTCTGTTAGAAATCCTCACCGAACAGTGTCTCACCCAYGAA[C/T]AGGTACAATTTCTGACTCAGCAACACTTCATTCATTCATTTATTCTGATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31922
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056432 | Nonsense | 432 | 1912 | 10 | 26 |
ENSDART00000133108 | None | 196 | None | 4 | |
ENSDART00000144612 | None | 207 | None | 2 |
The following transcripts of ENSDARG00000069397 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 21995980)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 21725318 GRCz11 13 21855768 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCAAGTAAAACAATGTTTTTACTTCTCTATTTGTAACTCCTCAGGCGTT[T/A]GGAACTTGCTGCCCAACTAAAGCAGTGGCACCTGAAGGTGATCGAGATTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11173
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056432 | Nonsense | 851 | 1912 | 11 | 26 |
ENSDART00000133108 | None | 196 | None | 4 | |
ENSDART00000144612 | None | 207 | None | 2 |
The following transcripts of ENSDARG00000069397 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 22000272)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 21729610 GRCz11 13 21860060 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTGCCTGTGCAGAGGCWCTCTATGCTCACGGCTACAGTAATGAAGCATG[T/A]CGACTAGCTGTCGAWCTTGCTCGAGATCTGCTGGCTAACCCTCCTGATCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28097
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056432 | Nonsense | 905 | 1912 | 12 | 26 |
ENSDART00000133108 | None | 196 | None | 4 | |
ENSDART00000144612 | None | 207 | None | 2 |
The following transcripts of ENSDARG00000069397 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 22000525)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 21729863 GRCz11 13 21860313 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGGTGGCCACCAACACCCTGTCTAAAGTAGCCTTCCTGCTGACAGTAT[T/A]GAGTGAGAGGCTGGAGCTCCATAACCTGGCCTTCAACACTGGCATGTTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7226
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site, Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056432 | Splice Site | None | 1912 | None | 26 |
ENSDART00000133108 | Essential Splice Site | 151 | 196 | 4 | 4 |
ENSDART00000144612 | None | 207 | None | 2 |
The following transcripts of ENSDARG00000069397 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 22004786)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 21734124 GRCz11 13 21864574 - KASP Assay ID:
- 554-5275.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTGTAGTGGGCAAGATTAAATTCTTATTTCCTTACTCGTACYTTTGATTT[A/G]GCAGAAGGTGCGCAGTCGACCTCCTGTGATCAGCAGAGTGAAGCTGCACC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22278
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056432 | Nonsense | 1513 | 1912 | 21 | 26 |
ENSDART00000133108 | None | 196 | None | 4 | |
ENSDART00000144612 | Nonsense | 21 | 207 | 1 | 2 |
The following transcripts of ENSDARG00000069397 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 22010539)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 21739877 GRCz11 13 21870327 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTGGTATTGGCTTTATGAACAAACCGTTGGCGGTGGTTCGGGATCTCAG[C/T]GAGAAGGTTCCGGACGCTGCGGGGCCAATGGTGGAGCTGGGAGAACGCCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: