Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-27b3.6
- Ensembl ID:
- ENSDARG00000069390
- ZFIN ID:
- ZDB-GENE-091204-22
- Human Orthologue:
- ITGA2
- Human Description:
- integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) [Source:HGNC Symbol;Acc:6137]
- Mouse Orthologue:
- Itga2
- Mouse Description:
- integrin alpha 2 Gene [Source:MGI Symbol;Acc:MGI:96600]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa34850 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa34850
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000100947 | Nonsense | 219 | 293 | 6 | 9 |
| ENSDART00000140894 | None | 254 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 10 (position 8948002)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 9023958 GRCz11 10 8857517 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATAAGCAGAAAGTTCTTTTAGCGGCTTCTGATATTGACCAACAAACTGGT[C/T]AGGAGACCAACACATTTGCAGCACTCGACAAAACAAGGTACCCTACACCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
