zgc:158868

Ensembl ID:
ENSDARG00000069379
ZFIN ID:
ZDB-GENE-070112-892
Description:
hypothetical protein LOC791147 [Source:RefSeq peptide;Acc:NP_001074098]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32207 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32207
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082922 Nonsense 91 258 3 6
ENSDART00000147230 Nonsense 111 278 3 6
Genomic Location (Zv9):
Chromosome 18 (position 21892993)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22123216
GRCz11 18 22112282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCAAAGAGGCTTCAAACTTAGTGGAATCCAAGCTGAACGGCAAAGGCT[T/G]AAATCTGATCATCAACAATGCTGGTGTGAACATCCCAGGTTCCCTAGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link