zgc:153115

Ensembl ID:
ENSDARG00000069342
ZFIN ID:
ZDB-GENE-061013-418
Description:
Krueppel-like factor 16 [Source:RefSeq peptide;Acc:NP_001070797]
Human Orthologue:
KLF13
Human Description:
Kruppel-like factor 13 [Source:HGNC Symbol;Acc:13672]
Mouse Orthologue:
Klf13
Mouse Description:
Kruppel-like factor 13 Gene [Source:MGI Symbol;Acc:MGI:1354948]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13767 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13767
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100819 Nonsense 186 186 3 3
ENSDART00000131012 Nonsense 250 250 2 2
ENSDART00000146434 Nonsense 250 250 3 3
Genomic Location (Zv9):
Chromosome 2 (position 6946662)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7370232
GRCz11 2 7241838
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCGGCTCAGGGATCCRTTTCCATCCAGCCTGCTGCCGCCAGCACTGCC[G/T]AGTAAAACGCCGGGACCCCCGCCTTCTGCACTGTGACCACCATATYTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link