zgc:152863

Ensembl ID:
ENSDARG00000069338
ZFIN ID:
ZDB-GENE-061103-463
Description:
hypothetical protein LOC562658 [Source:RefSeq peptide;Acc:NP_001073469]
Human Orthologues:
KIAA0247, SUSD4
Human Descriptions:
KIAA0247 [Source:HGNC Symbol;Acc:19956]
sushi domain containing 4 [Source:HGNC Symbol;Acc:25470]
Mouse Orthologues:
4933426M11Rik, Susd4
Mouse Descriptions:
RIKEN cDNA 4933426M11 gene Gene [Source:MGI Symbol;Acc:MGI:2444661]
sushi domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2138351]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6379 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115166 Essential Splice Site 59 213 4 5
Genomic Location (Zv9):
Chromosome 15 (position 24826434)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25559932
GRCz11 15 25495197
KASP Assay ID:
554-5140.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGAAGGAAGTCTTTAAATGGTTTGYGTTTGTGTGTTTCTTTTTTAAC[A/C]GACGGTCATGGTGAACAGCAAGAAAAAATCATCAGCTCTATTCCGAGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link