zgc:114045

Ensembl ID:
ENSDARG00000069334
ZFIN ID:
ZDB-GENE-050913-119
Description:
hypothetical protein LOC569643 [Source:RefSeq peptide;Acc:NP_001025409]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14791 Essential Splice Site Available for shipment Available now
sa5406 Nonsense Mutation detected in F1 DNA During 2018
sa38602 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14791
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100804 Essential Splice Site 56 246 None 8
ENSDART00000113793 Essential Splice Site 56 246 None 8
ENSDART00000145832 Essential Splice Site 56 207 None 5
ENSDART00000146335   None 253 None 9

The following transcripts of ENSDARG00000069334 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 21268100)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19858536
GRCz11 7 20110504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGACATCACCGTGGGGTGCTTCGTGTGCACGTCATGCTCCGGAATGTTG[T/A]GARTTATAATACCCAAGTGCATGYGATTATTAGTGATTACAAACAGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5406
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100804 Nonsense 100 246 3 8
ENSDART00000113793 Nonsense 100 246 3 8
ENSDART00000145832 Nonsense 100 207 3 5
ENSDART00000146335   None 253 None 9

The following transcripts of ENSDARG00000069334 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 21275565)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19866001
GRCz11 7 20117969
KASP Assay ID:
554-3546.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGGGTTGTTAGGTTGGAAGGAGGACCTGGCTCTGCACATTTGACCCC[A/T]AAACCGACGGCTGTTTTGATGCACGTGACACGCAGAAGCTGAAGGAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100804 Essential Splice Site 238 246 7 8
ENSDART00000113793   None 246 None 8
ENSDART00000145832   None 207 None 5
ENSDART00000146335 Essential Splice Site 41 253 2 9

The following transcripts of ENSDARG00000069334 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 21282932)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19873368
GRCz11 7 20125336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCCTTATTTCACAGCCAGTAGCACTTTCAAAAACAGCTTTACTTTAGG[T/G]AAGTCCCATAATCGCACACTGCAGACACTTCAGCTGTACCTCAGACCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link