vps53

Ensembl ID:
ENSDARG00000069324
ZFIN IDs:
ZDB-GENE-041114-199, ZDB-GENE-041114-199
Description:
vacuolar protein sorting 53 homolog [Source:RefSeq peptide;Acc:NP_001007459]
Human Orthologue:
VPS53
Human Description:
vacuolar protein sorting 53 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25608]
Mouse Orthologue:
Vps53
Mouse Description:
vacuolar protein sorting 53 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1915549]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24985 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6378 Nonsense Mutation detected in F1 DNA During 2018
sa18666 Nonsense Available for shipment Available now
sa32036 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078095 Essential Splice Site None 158 2 9
ENSDART00000122184 Essential Splice Site 30 832 2 22
Genomic Location (Zv9):
Chromosome 15 (position 24505875)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25217062
GRCz11 15 25152327
KASP Assay ID:
554-7363.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTATGTTTTTGTTCATGTTATTTGTTATTTGTATGATTTCTTTTTTA[G/A]GTTTTTCCCAGTCAAGACCCATTAGATCGAGCTGATTTTAATGCTGTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078095   None 158 4 9
ENSDART00000122184 Nonsense 86 832 4 22
Genomic Location (Zv9):
Chromosome 15 (position 24504809)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25215996
GRCz11 15 25151261
KASP Assay ID:
554-4407.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTNCTAATCAGAAAGTTGGATGACAATATCAGAACAGTGGTGAGGGGA[C/T]AGACGAATGTGGGGCAAGATGGCAGACAAGTGAGTTTTTAATTTCCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18666
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078095   None 158 None 9
ENSDART00000122184 Nonsense 276 832 9 22
Genomic Location (Zv9):
Chromosome 15 (position 24481573)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25192760
GRCz11 15 25128025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTCATCCGGCARCACCTTTCAGAATACATGGTGCTTTTTCAAGAGAAT[C/T]AAGATGTGAGTGTGACTTTTATTTATWTRATAATACTGTGAAGTGCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32036
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078095 Essential Splice Site 101 158 8 9
ENSDART00000122184 Essential Splice Site 775 832 21 22
Genomic Location (Zv9):
Chromosome 15 (position 24456251)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25167438
GRCz11 15 25102703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTGCCGACAGCAATCCTGAAACCTTCCAGAAGATTCTAGATATGAAGG[T/A]AAGTAAGGCTGCGCTTCATCTGTTTCATGAGATCTGTAGAACAGAGTAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link