tmem199

Ensembl ID:
ENSDARG00000069314
ZFIN ID:
ZDB-GENE-050522-150
Description:
transmembrane protein 199 [Source:RefSeq peptide;Acc:NP_001099067]
Human Orthologue:
TMEM199
Human Description:
transmembrane protein 199 [Source:HGNC Symbol;Acc:18085]
Mouse Orthologue:
Tmem199
Mouse Description:
transmembrane protein 199 Gene [Source:MGI Symbol;Acc:MGI:2144113]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32034 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32034
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100756 Essential Splice Site 114 144 6 6
Genomic Location (Zv9):
Chromosome 15 (position 24027374)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24738561
GRCz11 15 24673826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCTATTCTAAAATACGCATAATGTCTCTGTATTGTTTTTTTTTATTTC[A/G]GAGAGTAATAGCTGCCGTTATTGCAGCATCTGTTGTCGGCCTTGCTGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link