tmem177

Ensembl ID:
ENSDARG00000069301
ZFIN ID:
ZDB-GENE-030131-993
Description:
Transmembrane protein 177 [Source:UniProtKB/Swiss-Prot;Acc:Q6PBI8]
Human Orthologue:
TMEM177
Human Description:
transmembrane protein 177 [Source:HGNC Symbol;Acc:28143]
Mouse Orthologue:
Tmem177
Mouse Description:
transmembrane protein 177 Gene [Source:MGI Symbol;Acc:MGI:1913593]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38745 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38745
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100744 Nonsense 180 310 2 2
Genomic Location (Zv9):
Chromosome 9 (position 30069004)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29224950
GRCz11 9 29035696
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGGGTCTGGAGGACCCATCTTGCACGCTGCAGTGGCTCCGGTATGTT[T/A]GGCTGGGGCTTGTGTCTATAGCGTGGCCCTCAAACAGATCTTCAGGTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link