si:dkeyp-89c11.1

Ensembl ID:
ENSDARG00000069292
ZFIN ID:
ZDB-GENE-041210-201
Description:
Novel protein containing an Acyl-CoA thioester hydrolase / Bile acid-CoA amino acid N-acetyltransfer
Human Orthologues:
ACOT1, ACOT2, ACOT4, ACOT6, BAAT
Human Descriptions:
acyl-CoA thioesterase 1 [Source:HGNC Symbol;Acc:33128]
acyl-CoA thioesterase 2 [Source:HGNC Symbol;Acc:18431]
acyl-CoA thioesterase 4 [Source:HGNC Symbol;Acc:19748]
acyl-CoA thioesterase 6 [Source:HGNC Symbol;Acc:33159]
bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase) [Source:HGNC Symbol;Acc:9
Mouse Orthologues:
Acnat1, Acnat2, Acot1, Acot2, Acot3, Acot4, Acot5, Acot6, Baat
Mouse Descriptions:
acyl-CoA thioesterase 1 Gene [Source:MGI Symbol;Acc:MGI:1349396]
acyl-CoA thioesterase 2 Gene [Source:MGI Symbol;Acc:MGI:2159605]
acyl-CoA thioesterase 3 Gene [Source:MGI Symbol;Acc:MGI:2159619]
acyl-CoA thioesterase 4 Gene [Source:MGI Symbol;Acc:MGI:2159621]
acyl-CoA thioesterase 5 Gene [Source:MGI Symbol;Acc:MGI:2384969]
acyl-CoA thioesterase 6 Gene [Source:MGI Symbol;Acc:MGI:1921287]
acyl-coenzyme A amino acid N-acyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:2140197]
acyl-coenzyme A amino acid N-acyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2444345]
bile acid-Coenzyme A: amino acid N-acyltransferase Gene [Source:MGI Symbol;Acc:MGI:106642]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10802 Nonsense Available for shipment Available now
sa20291 Nonsense Available for shipment Available now
sa7319 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa16197 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10802
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100693 Nonsense 26 229 2 6
ENSDART00000100714 Nonsense 63 450 3 14
ENSDART00000100717 Nonsense 84 470 3 12
Genomic Location (Zv9):
Chromosome 4 (position 24742630)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25666299
GRCz11 4 25655497
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATAAAGAATTTACTGCCAAATCAAGAGGTAAYGCTRCACTCTCTACAT[C/T]AGTCTGAAGATARGGACTKCTGGGAGGCTTTTGGACACTATATYAGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100693 Nonsense 141 229 4 6
ENSDART00000100714 Nonsense 178 450 5 14
ENSDART00000100717 Nonsense 199 470 5 12
Genomic Location (Zv9):
Chromosome 4 (position 24743554)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25667223
GRCz11 4 25656421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGGTGTACAGAGGGTGGACATAAGAGAGAACGGAGTTCAAGGAACTT[T/A]ATTTCTTCCCCCAGGTAAAATACGATTCATGCGATATTTAAGTTCACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7319
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100693   None 229 None 6
ENSDART00000100714 Essential Splice Site 401 450 11 14
ENSDART00000100717 Missense 423 470 11 12
Genomic Location (Zv9):
Chromosome 4 (position 24749109)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25672778
GRCz11 4 25661976
KASP Assay ID:
554-4479.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGTCATTTGATTRAACCTCCATACACACCTCACTTCAGAGCAACTAAY[G/T]TYCTCCTGCATAAAAAGGAGAAAGGCAAGCATACATGATCCATTCYATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16197
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100693   None 229 None 6
ENSDART00000100714   None 450 None 14
ENSDART00000100717 Nonsense 427 470 11 12
Genomic Location (Zv9):
Chromosome 4 (position 24749121)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25672790
GRCz11 4 25661988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTRAACCTCCATACACACCTCACTTCAGAGCAACTAAYKTYCTCCTGCAT[A/T]AAAAGGAGAAAGGCAAGCATACATGATCCMTTCYATTGTTGCCTTCTGWT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link