Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ercc8
- Ensembl ID:
- ENSDARG00000069283
- ZFIN ID:
- ZDB-GENE-041010-60
- Description:
- DNA excision repair protein ERCC-8 [Source:RefSeq peptide;Acc:NP_001005984]
- Human Orthologue:
- ERCC8
- Human Description:
- excision repair cross-complementing rodent repair deficiency, complementation group 8 [Source:HGNC S
- Mouse Orthologue:
- Ercc8
- Mouse Description:
- excision repaiross-complementing rodent repair deficiency, complementation group 8 Gene [Source:MGI
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa10326 | Splice Site, Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10326
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Splice Site, Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000100698 | Splice Site, Nonsense | 58 | 400 | 3 | 12 |
| ENSDART00000134265 | Splice Site, Nonsense | 58 | 178 | 3 | 6 |
The following transcripts of ENSDARG00000069283 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 17260147)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 16705035 GRCz11 8 16740747 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGCAATATATCTATACATGTGGTTAACGTCCAGCCTGTTTTGCATTCCAG[T/G]ATGCTGTCAGGCGGATCTGATGGCGTAATTGTGATTTATGACTTRGAGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
