zgc:175162

Ensembl ID:
ENSDARG00000069280
ZFIN ID:
ZDB-GENE-041008-211
Description:
tRNA splicing endonuclease 15 [Source:RefSeq peptide;Acc:NP_001093560]
Human Orthologue:
TSEN15
Human Description:
tRNA splicing endonuclease 15 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:16791]
Mouse Orthologue:
Tsen15
Mouse Description:
tRNA splicing endonuclease 15 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913887]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16551 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16551
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100696 Essential Splice Site 92 147 3 4
Genomic Location (Zv9):
Chromosome 2 (position 9736928)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10150211
GRCz11 2 9948031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGATGATTTACCCTCTGCCTTCACACAGATCYATCAAGCACAGAGAG[T/C]AAGGGTGCTTCCACACTTGTGNTTCGATTCAGTTGTTCYGAAACAGAGATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link