zgc:158613

Ensembl ID:
ENSDARG00000069262
ZFIN ID:
ZDB-GENE-070209-295
Description:
Zgc:158613 protein [Source:UniProtKB/TrEMBL;Acc:A2RV17]
Human Orthologue:
C1orf173
Human Description:
chromosome 1 open reading frame 173 [Source:HGNC Symbol;Acc:25346]
Mouse Orthologue:
4922501L14Rik
Mouse Description:
RIKEN cDNA 4922501L14 gene Gene [Source:MGI Symbol;Acc:MGI:1919095]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38680 Nonsense Mutation detected in F1 DNA During 2018
sa31639 Nonsense Available for shipment Available now
sa21247 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100651 Nonsense 67 650 3 12
Genomic Location (Zv9):
Chromosome 8 (position 18454726)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17899614
GRCz11 8 17935326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAAGCACAAGCTGATCCGGCGAGCGCATCAGAGACATGTGAGAGAGTG[T/A]CTGGCTCAAGCCATCTTTCACAAGGTGCTAGACATGGAGGTGAGAGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31639
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100651 Nonsense 200 650 6 12
Genomic Location (Zv9):
Chromosome 8 (position 18457609)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17902497
GRCz11 8 17938209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCCAGAGAACAGGACTCCTCCAACGACACCGATCAGCCCGTCAGTTA[T/A]ACGGTGACACCCTCCTGACATCCTAATACGTACACTCTCACTCATCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21247
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100651 Nonsense 277 650 8 12
Genomic Location (Zv9):
Chromosome 8 (position 18460437)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17905325
GRCz11 8 17941037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGCAATTCCTCTGTTTGCAGCCATCTTCTCTTCAGAGGACATCAGCC[C/T]AGAGTAAAGTGTTAGTGAGCATGATGTATTTTGGGAAGGGTGTCCACCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link