zgc:136888

Ensembl ID:
ENSDARG00000069260
ZFIN ID:
ZDB-GENE-060421-4898
Description:
meiotic recombination protein REC8 homolog [Source:RefSeq peptide;Acc:NP_001035468]
Human Orthologue:
REC8
Human Description:
REC8 homolog (yeast) [Source:HGNC Symbol;Acc:16879]
Mouse Orthologue:
Rec8
Mouse Description:
REC8 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1929645]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30055 Nonsense Mutation detected in F1 DNA During 2018
sa10120 Essential Splice Site Available for shipment Available now
sa45821 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100644 Nonsense 274 564 10 18
Genomic Location (Zv9):
Chromosome 24 (position 12623241)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12574978
GRCz11 24 12721272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGAAGGTAATGGACGTTTTACAGAGGTCACCTTAGACCGAGTCGCTT[T/A]AGAGATGACGCCTCCCCCAATCACTATGACAACAACCACGGACGCCAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10120
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100644 Essential Splice Site 300 564 10 18
Genomic Location (Zv9):
Chromosome 24 (position 12623321)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12575058
GRCz11 24 12721352
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACAACCACGGACGCCAGCGAGAGAGATGTGGAGATGGAGTCCAGTGAG[G/A]TTGGTGTCTGTATTACCTTGCCCATTATACTCAAGTGTTACATAATCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45821
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100644 Nonsense 500 564 16 18
Genomic Location (Zv9):
Chromosome 24 (position 12632857)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12584594
GRCz11 24 12730888
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATCTGCCCCTGGGAGAGGCGGAGCTTGAGATGAGTGACATCATCACC[G/T]AGGACTTATTCAGGTGAATTGAGGCCAAGCAGATGTAAAAGCATATCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link