
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
uaca
- Ensembl ID:
- ENSDARG00000069250
- ZFIN ID:
- ZDB-GENE-050419-37
- Description:
- Novel protein similar to vertebrate uveal autoantigen with coiled-coil domains and ankyrin repeats (
- Human Orthologue:
- UACA
- Human Description:
- uveal autoantigen with coiled-coil domains and ankyrin repeats [Source:HGNC Symbol;Acc:15947]
- Mouse Orthologue:
- Uaca
- Mouse Description:
- uveal autoantigen with coiled-coil domains and ankyrin repeats Gene [Source:MGI Symbol;Acc:MGI:19198
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23283 | Essential Splice Site | Available for shipment | Available now |
sa23284 | Nonsense | Available for shipment | Available now |
sa23285 | Essential Splice Site, Missense | Available for shipment | Available now |
sa7446 | Missense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa23283
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000100628 | Essential Splice Site | 111 | 561 | 5 | 17 |
ENSDART00000146957 | Essential Splice Site | 106 | 761 | 4 | 14 |
- Genomic Location (Zv9):
- Chromosome 18 (position 19841848)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 20072071 GRCz11 18 20061137 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGGCTGCAGCCGGCGGTCACTCTGTGTGTGTGCAGAGTCTGCTGCAGG[T/C]ACGTGCATTATGTTTTCCCGCTAACAATTGCAGGAAGAAAGAGTAATGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23284
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000100628 | Nonsense | 253 | 561 | 10 | 17 |
ENSDART00000146957 | None | 761 | None | 14 |
- Genomic Location (Zv9):
- Chromosome 18 (position 19850316)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 20080539 GRCz11 18 20069605 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTCTAGTTTTTAAATCTTGTAGAAGATCCTCCCACGTGGTCTGTTTGTA[T/A]ACTGTGAAGCGTGCTCTATTGCACAGGTCTCAAACTGTAAAATTAAATGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23285
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > G
- Consequence:
- Essential Splice Site, Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000100628 | Essential Splice Site | 390 | 561 | None | 17 |
ENSDART00000146957 | Missense | 285 | 761 | 11 | 14 |
- Genomic Location (Zv9):
- Chromosome 18 (position 19856867)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 20087090 GRCz11 18 20076156 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGAAAGAGTGTGTTTTACTTTAACATTAGCCTTGTGAATTATTCAGGTC[A/G]GGCCCCCACAGTCGGCTCCAGCACCCGTGAGATCTGCCCCGATGGAGTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7446
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000100628 | None | 561 | None | 17 | |
ENSDART00000146957 | Missense | 729 | 761 | 13 | 14 |
- Genomic Location (Zv9):
- Chromosome 18 (position 19863402)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 20093625 GRCz11 18 20082691 - KASP Assay ID:
- 554-4083.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTCTTTTTTGCAGGAGTCTGGGAGGCATTACAGACATGTGCTTTCAGTA[T/A]ACAGAACACGGTTGCTCAGTGCAGCACAGGTAGCGTTTKACTTGCTTGTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: