si:dkey-9i9.2

Ensembl ID:
ENSDARG00000069246
ZFIN ID:
ZDB-GENE-050419-246
Description:
Novel protein similar to vertebrate relaxin 3 receptor 2 (RLN3R2) [Source:UniProtKB/TrEMBL;Acc:A8E7S

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11336 Nonsense Available for shipment Available now
sa43089 Nonsense Mutation detected in F1 DNA During 2018
sa23282 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11336
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100624 Nonsense 29 343 2 2
ENSDART00000128921 Nonsense 33 342 2 2
ENSDART00000132656 Nonsense 17 347 1 1
Genomic Location (Zv9):
Chromosome 18 (position 19811805)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20042028
GRCz11 18 20031094
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGGGTGACCCTTTCAGCAACAGCAGCAGGACATTCAACCGAACCCTG[C/T]AGAGTAAAGTCACATTTRGAAATCTGGAGGACATCGACGTGACCGCGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100624 Nonsense 118 343 2 2
ENSDART00000128921 Nonsense 122 342 2 2
ENSDART00000132656 Nonsense 106 347 1 1
Genomic Location (Zv9):
Chromosome 18 (position 19812074)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20042297
GRCz11 18 20031363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCTGACACTGCCTTTTTGGGCTGTAGACACCGCGCTGGATTTCAGCTG[G/A]CCGTTTGGAGACGCCATGTGCAAGATCATACTGTCCGTGACCGTGATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23282
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100624   None 343 None 2
ENSDART00000128921   None 342 None 2
ENSDART00000132656 Nonsense 335 347 1 1
Genomic Location (Zv9):
Chromosome 18 (position 19812760)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20042983
GRCz11 18 20032049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTTGAGGAAGAAACTGAAAAAATGTTTGTCCATTTTTGCCCCCTGGT[T/G]ATTAAAGAGCTCTCTACAGAAGTCCAGCAGGCATGCATAAATGGCACAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link