matn3a

Ensembl ID:
ENSDARG00000069245
ZFIN IDs:
ZDB-GENE-040822-21, ZDB-GENE-040822-21, ZDB-GENE-040822-21, ZDB-GENE-040822-21
Description:
matrilin 3a [Source:RefSeq peptide;Acc:NP_001004007]
Human Orthologue:
MATN3
Human Description:
matrilin 3 [Source:HGNC Symbol;Acc:6909]
Mouse Orthologue:
Matn3
Mouse Description:
matrilin 3 Gene [Source:MGI Symbol;Acc:MGI:1328350]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45716 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074631   319 337 4 7
ENSDART00000100608   None 253 None 6
ENSDART00000100609 Essential Splice Site 277 295 3 4
ENSDART00000100610 Essential Splice Site 442 460 6 7
Genomic Location (Zv9):
Chromosome 20 (position 43793124)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43864283
GRCz11 20 43761361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCTTTCCAGAGGCAAACACAAACCTCCATTCAGGACCTCAACGCCAA[G/A]CATATCCTTTTTGCCAAGTCCAAGAGTGCAACTACATTTCCCAGAATGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link