stx7l

Ensembl ID:
ENSDARG00000069208
ZFIN ID:
ZDB-GENE-041014-35
Description:
Novel protein similar to vertebrate syntaxin 7 (STX7) [Source:UniProtKB/TrEMBL;Acc:Q5RFY7]
Human Orthologue:
STX7
Human Description:
syntaxin 7 [Source:HGNC Symbol;Acc:11442]
Mouse Orthologue:
Stx7
Mouse Description:
syntaxin 7 Gene [Source:MGI Symbol;Acc:MGI:1858210]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37148 Nonsense Mutation detected in F1 DNA During 2018
sa1680 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37148
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100532 Nonsense 71 262 3 9
Genomic Location (Zv9):
Chromosome 20 (position 46108400)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46313573
GRCz11 20 46217293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAGAAGCAGCAGAGTGTCAATCAACTTGCTAAAGTGACAGATAAATG[C/A]ATGAAAGATTTCAGCTCTTTACCTGCGACCACAGAACAGGTACTATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1680
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100532 Essential Splice Site 147 262 5 9
Genomic Location (Zv9):
Chromosome 20 (position 46104563)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46317410
GRCz11 20 46221130
KASP Assay ID:
554-1626.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAGATATAGATGATGTGTTTGGAAGAGCTGCTCCAGCATTCCAAAGG[T/C]WAGTTAGTTAGATRCTTGTRTTGATCCTGAAGGAAATTCAGTGATCAAAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link