zgc:172120

Ensembl ID:
ENSDARG00000069199
ZFIN ID:
ZDB-GENE-080204-46
Description:
hypothetical protein LOC799440 [Source:RefSeq peptide;Acc:NP_001121748]
Human Orthologue:
CD276
Human Description:
CD276 molecule [Source:HGNC Symbol;Acc:19137]
Mouse Orthologue:
Cd276
Mouse Description:
CD276 antigen Gene [Source:MGI Symbol;Acc:MGI:2183926]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7374 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7374
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100514 Missense 101 273 2 4
Genomic Location (Zv9):
Chromosome 13 (position 33583084)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33229032
GRCz11 13 33359482
KASP Assay ID:
554-4226.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGTTACAGAGCTTCATAAGGGAAATGCATCTATCAGAATAGCAGCAG[T/G]TAGCTGGAAGGATGCTGGCCGGTACCTGTGCATAGTGAGCAATACAAAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link