si:dkeyp-68f9.10

Ensembl ID:
ENSDARG00000069186
ZFIN ID:
ZDB-GENE-081104-511
Human Orthologue:
CYP27A1
Human Description:
cytochrome P450, family 27, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2605]
Mouse Orthologue:
Cyp27a1
Mouse Description:
cytochrome P450, family 27, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88594]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6152 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa14111 Nonsense Available for shipment Available now
sa27447 Nonsense Mutation detected in F1 DNA During 2018
sa21546 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6152
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100487 Essential Splice Site 74 438 1 8
ENSDART00000135748 Missense 75 522 1 9

The following transcripts of ENSDARG00000069186 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39472576)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38610472
GRCz11 9 38420267
KASP Assay ID:
554-3659.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCTTTACCATGTTGTATCAAATGCTCTTCAAAGGKTACCTCAACAGC[G/A]TACATGAGCTACAGGTATAAAGAAATAACGCAGCTGTATTTGTTTRTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14111
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100487   None 438 None 8
ENSDART00000135748 Nonsense 133 522 2 9

The following transcripts of ENSDARG00000069186 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39472894)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38610790
GRCz11 9 38420585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAATATCCRTGCAGAGGAWMCATGACTCTGTGGACAGAGCAYCGGGACT[T/G]AAGAGGCATTAGCTATGGCCCTTTCACAGAGTAAAAACAAAKGATTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100487   None 438 None 8
ENSDART00000135748 Nonsense 138 522 2 9

The following transcripts of ENSDARG00000069186 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39472910)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38610806
GRCz11 9 38420601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATACATGACTCTGTGGACAGAGCACCGGGACTTAAGAGGCATTAGCTA[T/G]GGCCCTTTCACAGAGTAAAAACAAAGGATTTGTATAAATAACACTCGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21546
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100487 Nonsense 217 438 4 8
ENSDART00000135748 Nonsense 301 522 5 9

The following transcripts of ENSDARG00000069186 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39475782)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38613678
GRCz11 9 38423473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCCATTCAGAAGCGTGTAGATACCAATCAGGATGTTGCTGGAGAGTA[T/G]CTCACATACCTGCTTTCTAATGGCAAGATAAGCAGGAAAGACGTTTATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link