si:dkey-73n10.1

Ensembl ID:
ENSDARG00000069168
ZFIN ID:
ZDB-GENE-030131-9311
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KQ83]
Human Orthologue:
C15orf39
Human Description:
chromosome 15 open reading frame 39 [Source:HGNC Symbol;Acc:24497]
Mouse Orthologue:
1700017B05Rik
Mouse Description:
RIKEN cDNA 1700017B05 gene Gene [Source:MGI Symbol;Acc:MGI:1921461]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23281 Nonsense Available for shipment Available now
sa9924 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23281
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100458 Nonsense 314 986 2 4
ENSDART00000139015   None 160 None 2
ENSDART00000141378 Nonsense 88 760 1 3
Genomic Location (Zv9):
Chromosome 18 (position 18719784)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18950007
GRCz11 18 18939073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGTGCCCCAGTTCCTCCACAGATGTACAAGGGATATCCACATGCTTA[T/A]GACCCAAGGACATTGGCACACCCTGAAGTTTCTTCAAAAGTGTATCAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9924
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100458 Nonsense 956 986 2 4
ENSDART00000139015 Nonsense 113 160 1 2
ENSDART00000141378 Nonsense 730 760 1 3
Genomic Location (Zv9):
Chromosome 18 (position 18717858)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18948081
GRCz11 18 18937147
KASP Assay ID:
2261-2073.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCAAAACTCCGGAGACTTCTGTCCCTTAAACACCTGCCTGACATATA[C/A]CCTGATGTCCTCAACCTCCTCTACTATGCCAATGTCTGCAAGTTCCTCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link