
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tmem135
- Ensembl ID:
- ENSDARG00000069157
- ZFIN ID:
- ZDB-GENE-070424-70
- Description:
- transmembrane protein 135 [Source:RefSeq peptide;Acc:NP_001082887]
- Human Orthologue:
- TMEM135
- Human Description:
- transmembrane protein 135 [Source:HGNC Symbol;Acc:26167]
- Mouse Orthologue:
- Tmem135
- Mouse Description:
- transmembrane protein 135 Gene [Source:MGI Symbol;Acc:MGI:1920009]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16243 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16243
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000100430 | Essential Splice Site | 340 | 465 | 11 | 15 |
ENSDART00000123820 | Essential Splice Site | 340 | 465 | 11 | 15 |
- Genomic Location (Zv9):
- Chromosome 10 (position 25953553)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 25357410 GRCz11 10 25319078 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACTGAGATGGATGCGCAACCTGGATGATGAGCTCCACGCGCTTATAGCAG[G/A]TAAATTGTGAKTTGAACAGATGAATTTNAACATCTTATTAGAGGTCCTCAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: