zgc:153126

Ensembl ID:
ENSDARG00000069129
ZFIN ID:
ZDB-GENE-061103-76
Description:
hypothetical protein LOC777608 [Source:RefSeq peptide;Acc:NP_001071184]
Human Orthologue:
FHDC1
Human Description:
FH2 domain containing 1 [Source:HGNC Symbol;Acc:29363]
Mouse Orthologue:
Fhdc1
Mouse Description:
FH2 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2684972]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24875 Missense Mutation detected in F1 DNA During 2018
sa11455 Essential Splice Site Available for shipment Available now
sa34913 Nonsense Available for shipment Available now
sa10115 Nonsense Available for shipment Available now
sa21745 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24875
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100367   None 755 2 12
ENSDART00000136393 Missense 34 826 2 12

The following transcripts of ENSDARG00000069129 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 26835157)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26239014
GRCz11 10 26200727
KASP Assay ID:
554-7723.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGATCCCTCCAGGTGCTTTCAAAATGAAACCTCACCATTCAGACGTCCT[G/A]TCCAGCTTCCTCCCCTGGGCCCTCCACCTCCCCCTCCCCCTCCACCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11455
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100367 Essential Splice Site 286 755 9 12
ENSDART00000136393 Essential Splice Site 357 826 9 12

The following transcripts of ENSDARG00000069129 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 26828995)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26232852
GRCz11 10 26194565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTYTGTTGCACTTTACTGATCAGCTTCAACACATYGGAATTGCTGCCAGG[T/C]TAYTRCATATTTTTTGTAATMTGTAGAAGTTTTTTTTTTCTGGAGTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100367 Nonsense 305 755 10 12
ENSDART00000136393 Nonsense 376 826 10 12

The following transcripts of ENSDARG00000069129 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 26828862)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26232719
GRCz11 10 26194432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGCAGGAAGTGGAAATGGACTTTCAAAGGGAGTTGGAGAAAATTAAA[G/T]AAGCAAAAATGGACGCTAGCAAACAGCCGGATCTACTACATCAGATGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10115
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100367 Nonsense 435 755 12 12
ENSDART00000136393 Nonsense 506 826 12 12

The following transcripts of ENSDARG00000069129 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 26826498)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26230355
GRCz11 10 26192068
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAACAATGACAACTCCACTCTAGAATCTGTCCTGACCAGCTTTCTCAAG[C/T]AACGTCCTTCCCGCAGGAGGYCTRGTGGACCCACATCAGTCGCAAACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100367 Nonsense 537 755 12 12
ENSDART00000136393 Nonsense 608 826 12 12

The following transcripts of ENSDARG00000069129 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 26826191)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26230048
GRCz11 10 26191761
KASP Assay ID:
2260-3302.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAATCCCTGAAAGCAGTGATCGCAAACAAGATGAAGGAAGCAACACCT[C/A]GATCAAACAAAAACTTGAAGATGGAGTAGTGGATAAAAAAGAAGTAGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link