zgc:103754

Ensembl ID:
ENSDARG00000069109
ZFIN ID:
ZDB-GENE-041010-102
Description:
Sjogren syndrome/scleroderma autoantigen 1 [Source:RefSeq peptide;Acc:NP_001006010]
Human Orthologue:
SSSCA1
Human Description:
Sjogren syndrome/scleroderma autoantigen 1 [Source:HGNC Symbol;Acc:11328]
Mouse Orthologue:
Sssca1
Mouse Description:
Sjogren's syndrome/scleroderma autoantigen 1 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1913482

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34923 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100301 Nonsense 158 234 4 4
Genomic Location (Zv9):
Chromosome 10 (position 27467124)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26869918
GRCz11 10 26831631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGTACAGCCAACCCCTCTTTCCATCCCCACCCCTGCCTCCAACTTCT[T/A]GCCGCCATCCAACCCGCCTGTCCAGACGACACCTCCTGTAGGGTCTTCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link