zgc:112962

Ensembl ID:
ENSDARG00000069102
ZFIN ID:
ZDB-GENE-050410-15
Description:
lamina-associated polypeptide 1B [Source:RefSeq peptide;Acc:NP_001017552]
Human Orthologues:
TOR1AIP1, TOR1AIP2
Human Descriptions:
torsin A interacting protein 1 [Source:HGNC Symbol;Acc:29456]
torsin A interacting protein 2 [Source:HGNC Symbol;Acc:24055]
Mouse Orthologues:
Tor1aip1, Tor1aip2
Mouse Descriptions:
torsin A interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:3582693]
torsin A interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:3582695]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31648 Nonsense Available for shipment Available now
sa31647 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31648
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100288   None 324 None 5
ENSDART00000111600 Nonsense 151 723 8 22
ENSDART00000113749   None 445 1 15
ENSDART00000130481   None 180 None 9
ENSDART00000130746 Nonsense 156 735 7 22
ENSDART00000131371 Nonsense 151 293 8 13
ENSDART00000135204 Nonsense 156 195 8 9
ENSDART00000137606   None 129 None 7
ENSDART00000142852   None 180 None 9
ENSDART00000146532   None 129 None 7

The following transcripts of ENSDARG00000069102 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 21596417)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21026314
GRCz11 8 21058399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCTGACACACAGACATGCCGAAACCGATTTCCAGTGGCTCTCATACC[G/T]AAAAACTGTCTTACTCTAAACCTAACACTCTGAAAACAGCAGATGAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100288   None 324 None 5
ENSDART00000111600 Nonsense 281 723 14 22
ENSDART00000113749 Nonsense 12 445 7 15
ENSDART00000130481   None 180 None 9
ENSDART00000130746 Nonsense 286 735 13 22
ENSDART00000131371 Nonsense 267 293 13 13
ENSDART00000135204   None 195 None 9
ENSDART00000137606   None 129 None 7
ENSDART00000142852   None 180 None 9
ENSDART00000146532   None 129 None 7

The following transcripts of ENSDARG00000069102 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 21594075)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21023972
GRCz11 8 21056057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCTGACACACAGACATGCCGAAACCGATTTCCAGTGGCTCTCATACC[G/T]AAAAACTGTCTTACTCTAAACCTAACACTCTGAAAACAGCAGATGAAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link