zgc:136924

Ensembl ID:
ENSDARG00000069058
ZFIN ID:
ZDB-GENE-060312-19
Description:
hypothetical protein LOC556717 [Source:RefSeq peptide;Acc:NP_001034900]
Human Orthologues:
LGALS7, LGALS7B
Human Descriptions:
lectin, galactoside-binding, soluble, 7 [Source:HGNC Symbol;Acc:6568]
lectin, galactoside-binding, soluble, 7B [Source:HGNC Symbol;Acc:34447]
Mouse Orthologue:
Lgals7
Mouse Description:
lectin, galactose binding, soluble 7 Gene [Source:MGI Symbol;Acc:MGI:1316742]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7236 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7236
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100185 Nonsense 166 281 5 7
Genomic Location (Zv9):
Chromosome 15 (position 30320445)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31142152
GRCz11 15 31022893
KASP Assay ID:
554-4942.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGACCGTCCCATATAAAACCCTGATCAGTGATGGACTGCAGTCTGGC[A/T]AAGACATTNNNATTCATGGAGTTCCTAAAGCTGACTCAGACAGGTGAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link