zgc:162938

Ensembl ID:
ENSDARG00000069013
ZFIN ID:
ZDB-GENE-030131-1096
Description:
peroxiredoxin-4 [Source:RefSeq peptide;Acc:NP_001082894]
Human Orthologue:
PRDX4
Human Description:
peroxiredoxin 4 [Source:HGNC Symbol;Acc:17169]
Mouse Orthologue:
Prdx4
Mouse Description:
peroxiredoxin 4 Gene [Source:MGI Symbol;Acc:MGI:1859815]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31412 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31412
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100061 Nonsense 213 260 5 7
Genomic Location (Zv9):
Chromosome 5 (position 4323700)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 3983369
GRCz11 5 4316404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGGTGTCCTCAGACAGATCACTATGAATGACCTGCCGGTGGGCCGAT[C/A]GGTGGACGAGACCCTCAGACTGGTGCAGGCCTTCCAGTACACGGATAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link