zgc:153631

Ensembl ID:
ENSDARG00000068993
ZFIN ID:
ZDB-GENE-060825-208
Description:
hypothetical protein LOC751714 [Source:RefSeq peptide;Acc:NP_001038889]
Human Orthologues:
LTBR, TNFRSF11A, TNFRSF4
Human Descriptions:
lymphotoxin beta receptor (TNFR superfamily, member 3) [Source:HGNC Symbol;Acc:6718]
tumor necrosis factor receptor superfamily, member 11a, NFKB activator [Source:HGNC Symbol;Acc:11908
tumor necrosis factor receptor superfamily, member 4 [Source:HGNC Symbol;Acc:11918]
Mouse Orthologues:
Ltbr, Tnfrsf11a, Tnfrsf4
Mouse Descriptions:
lymphotoxin B receptor Gene [Source:MGI Symbol;Acc:MGI:104875]
tumor necrosis factor receptor superfamily, member 11a Gene [Source:MGI Symbol;Acc:MGI:1314891]
tumor necrosis factor receptor superfamily, member 4 Gene [Source:MGI Symbol;Acc:MGI:104512]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7133 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100014 Nonsense 13 278 1 8
ENSDART00000142883 Nonsense 80 345 3 10
ENSDART00000146457 Nonsense 80 233 3 6

The following transcripts of ENSDARG00000068993 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 22967514)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22338690
GRCz11 8 22359929
KASP Assay ID:
554-4629.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGCCCTGCGATGACATACACCAATGTTCCAAATGGATTCACTGAATG[T/A]CTGCCATGCTCTGTCTGTGATCCCAGTGAGTAAAAATKAGTTTTTTTYCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link