
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
glo1
- Ensembl ID:
- ENSDARG00000068978
- ZFIN ID:
- ZDB-GENE-030722-9
- Description:
- lactoylglutathione lyase [Source:RefSeq peptide;Acc:NP_998316]
- Human Orthologue:
- GLO1
- Human Description:
- glyoxalase I [Source:HGNC Symbol;Acc:4323]
- Mouse Orthologue:
- Glo1
- Mouse Description:
- glyoxalase 1 Gene [Source:MGI Symbol;Acc:MGI:95742]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35581 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35581
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099984 | Nonsense | 70 | 180 | 3 | 6 |
- Genomic Location (Zv9):
- Chromosome 13 (position 45423929)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 44667428 GRCz11 13 44804332 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGAAGTTTGATTTCCCCTCGATGCGCTTCACCCTCTACTTTCTGGGTTA[C/A]GAAGATAAGAAAGAGATCCCTGCAGATGTGAAGGAGAGGACGGCCTGGAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: