zgc:153372

Ensembl ID:
ENSDARG00000068967
ZFIN ID:
ZDB-GENE-060929-680
Description:
hypothetical protein LOC767695 [Source:RefSeq peptide;Acc:NP_001070101]
Human Orthologue:
AS3MT
Human Description:
arsenic (+3 oxidation state) methyltransferase [Source:HGNC Symbol;Acc:17452]
Mouse Orthologue:
As3mt
Mouse Description:
arsenic (+3 oxidation state) methyltransferase Gene [Source:MGI Symbol;Acc:MGI:1929882]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14814 Essential Splice Site Available for shipment Available now
sa4615 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa14814
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099958 Essential Splice Site 244 358 7 11
Genomic Location (Zv9):
Chromosome 15 (position 29081828)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29799858
GRCz11 15 29732734
KASP Assay ID:
2260-8653.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGGAAGTCACATTGTGGTTCACAACTCAGAACTTCAAAGAAAGATTG[G/A]TAATCYGTTTATTTGGGGTTTGGTTACAGCTTCATAGCTATTTTTGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4615
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099958 Nonsense 249 358 8 11
Genomic Location (Zv9):
Chromosome 15 (position 29081967)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29799997
GRCz11 15 29732873
KASP Assay ID:
554-3527.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCAGTGTTATTTTGACCTCCAATTGGTCACTGCAGGTGATGTCAAATA[T/G]GCAWCTGGAACTTATCGGATCTTTAAACTTCCTCAAAACTCCACCAAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link