zgc:153893

Ensembl ID:
ENSDARG00000068939
ZFIN ID:
ZDB-GENE-060929-840
Description:
XIAP-associated factor 1 [Source:RefSeq peptide;Acc:NP_001070115]
Human Orthologue:
XAF1
Human Description:
XIAP associated factor 1 [Source:HGNC Symbol;Acc:30932]
Mouse Orthologue:
Xaf1
Mouse Description:
XIAP associated factor 1 Gene [Source:MGI Symbol;Acc:MGI:3772572]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35908 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35908
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099885   None 270 1 8
ENSDART00000138449 Essential Splice Site None 149 None 6

The following transcripts of ENSDARG00000068939 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 28511171)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29229201
GRCz11 15 29162077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACACATAACAAGATATGTTTATAAATCAGAGATGTTTACGTCACCTGG[T/A]AAGTTTCGGTTCCGCTTTCTGTTCTGGATAAGTGAAAGTCCCAAGTCGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link