
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cyp1b1
- Ensembl ID:
- ENSDARG00000068934
- ZFIN ID:
- ZDB-GENE-030902-1
- Description:
- cytochrome P450, family 1, subfamily B, polypeptide 1 [Source:RefSeq peptide;Acc:NP_001139180]
- Human Orthologue:
- CYP1B1
- Human Description:
- cytochrome P450, family 1, subfamily B, polypeptide 1 [Source:HGNC Symbol;Acc:2597]
- Mouse Orthologue:
- Cyp1b1
- Mouse Description:
- cytochrome P450, family 1, subfamily b, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88590]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2716 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa2716
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099870 | Nonsense | 177 | 526 | 1 | 3 |
ENSDART00000126013 | Nonsense | 177 | 526 | 1 | 3 |
ENSDART00000131147 | Nonsense | 177 | 526 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 13 (position 42664980)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 41886029 GRCz11 13 42011999 - KASP Assay ID:
- 554-3362.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGAGCTCATCCGTCTTTTTCTCAATAAATCCCGCGAGCAGCAGTTTTTC[C/T]AGCCGCACCGGTATTTAGTGGTGTCGGTGGCGAACACGATGAGCGCCGTG
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: