
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch73-19n18.2
- Ensembl ID:
- ENSDARG00000068923
- ZFIN ID:
- ZDB-GENE-091204-140
- Description:
- LOC567806 protein [Source:UniProtKB/TrEMBL;Acc:A1L2F9]
- Human Orthologue:
- UMODL1
- Human Description:
- uromodulin-like 1 [Source:HGNC Symbol;Acc:12560]
- Mouse Orthologue:
- Umodl1
- Mouse Description:
- uromodulin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1929785]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10685 | Essential Splice Site | Available for shipment | Available now |
sa30942 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa10242 | Essential Splice Site | Available for shipment | Available now |
sa27634 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa18380 | Nonsense | Available for shipment | Available now |
sa41690 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa10685
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099853 | Essential Splice Site | 106 | 950 | 2 | 17 |
ENSDART00000126952 | Essential Splice Site | 106 | 927 | 2 | 16 |
- Genomic Location (Zv9):
- Chromosome 10 (position 33590793)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 32692142 GRCz11 10 32636002 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAAGACATGTTGCCATGGCTAMGAACAAGTTGGTAGTTACTGTGCCTTGC[G/A]TRAGTATKTTCAACTAAATCAGAGTGAAAGTGGAAAGTGAAGGAATGCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30942
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099853 | Nonsense | 198 | 950 | 4 | 17 |
ENSDART00000126952 | Nonsense | 198 | 927 | 4 | 16 |
- Genomic Location (Zv9):
- Chromosome 10 (position 33590347)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 32691696 GRCz11 10 32635556 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGACAACCTATGAGCTATTGGCAATCGACAAAGGTCTCTTGAACCACACC[A/T]GACTGCTTCACTCTGTGGTTTGTAATCATTTGCTGTATAAAGTGCCTGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10242
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099853 | Essential Splice Site | 569 | 950 | 11 | 17 |
ENSDART00000126952 | Essential Splice Site | 546 | 927 | 10 | 16 |
- Genomic Location (Zv9):
- Chromosome 10 (position 33580191)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 32681540 GRCz11 10 32625400 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTGRATACAYAGACTTGAACCCCAGAAGACCGGGACGCAGCTGTGCAGG[T/C]ACACACTGTGGAAAACGCTACTGTWGAGATTTCATTAGACTGGCACACAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa27634
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099853 | Nonsense | 674 | 950 | 12 | 17 |
ENSDART00000126952 | Nonsense | 651 | 927 | 11 | 16 |
- Genomic Location (Zv9):
- Chromosome 10 (position 33577070)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 32678419 GRCz11 10 32622279 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCGAGATTACCTCAAGGCCAATAACATCTCAGAGACCTCCTTGTATCTT[G/T]GAAATCCTGAATGCGGGCCCGTTGGGTTTGATGATTCTTATTTGTGGCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18380
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099853 | Nonsense | 900 | 950 | 16 | 17 |
ENSDART00000126952 | Nonsense | 877 | 927 | 15 | 16 |
- Genomic Location (Zv9):
- Chromosome 10 (position 33568742)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 32670091 GRCz11 10 32613951 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTTGTGACCGTCTTCTAAGTGCCAGGTCTTCTAAATTATTTGGACTGACC[C/T]GATCYGTTGGACCCTTAAACAGATTACACACAAGTAAATGCTTYTTATTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41690
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099853 | Essential Splice Site | 910 | 950 | 16 | 17 |
ENSDART00000126952 | Essential Splice Site | 887 | 927 | 15 | 16 |
- Genomic Location (Zv9):
- Chromosome 10 (position 33568708)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 32670057 GRCz11 10 32613917 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTATTTGGACTGACCCGATCCGTTGGACCCTTAAACAGATTACACACAA[G/A]TAAATGCTTTTTATTTAATGCATGTGAATATCCACAGCCTTCCATGATAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: