znf644

Ensembl ID:
ENSDARG00000068920
ZFIN ID:
ZDB-GENE-030131-6244
Description:
Novel protein similar to vertebrate zinc finger protein 644 (ZNF644) [Source:UniProtKB/TrEMBL;Acc:A2
Human Orthologue:
ZNF644
Human Description:
zinc finger protein 644 [Source:HGNC Symbol;Acc:29222]
Mouse Orthologue:
Zfp644
Mouse Description:
zinc finger protein 644 Gene [Source:MGI Symbol;Acc:MGI:1277212]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39815 Nonsense Mutation detected in F1 DNA During 2018
sa39816 Nonsense Mutation detected in F1 DNA During 2018
sa30817 Nonsense Mutation detected in F1 DNA During 2018
sa39817 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39815
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099848 Nonsense 161 1169 1 5
ENSDART00000131630 Nonsense 161 1169 2 6
Genomic Location (Zv9):
Chromosome 2 (position 23022340)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22867574
GRCz11 2 22523225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCATATGGGGCTTTGATAACGAATCTCCAGAAGCCTCATTAGATAATTA[T/A]GATGATGCTAATGACCTTGGCTGGAATCCCCAACGAGAGTTTATGAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39816
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099848 Nonsense 234 1169 1 5
ENSDART00000131630 Nonsense 234 1169 2 6
ENSDART00000099848 Nonsense 234 1169 1 5
ENSDART00000131630 Nonsense 234 1169 2 6
Genomic Location (Zv9):
Chromosome 2 (position 23022558)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22867356
GRCz11 2 22523007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAAATTGGTGCTAAAAGTTGACCCTTCAGAGGACCCCTTCTCTGATT[T/A]GAATTTAGATTCAAAACAAGATCACCCTGGTGAAGGAAGCCCGATAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099848 Nonsense 234 1169 1 5
ENSDART00000131630 Nonsense 234 1169 2 6
ENSDART00000099848 Nonsense 234 1169 1 5
ENSDART00000131630 Nonsense 234 1169 2 6
Genomic Location (Zv9):
Chromosome 2 (position 23022558)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22867356
GRCz11 2 22523007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAAATTGGTGCTAAAAGTTGACCCTTCAGAGGACCCCTTCTCTGATT[T/A]GAATTTAGATTCAAAACAAGATCACCCTGGTGAAGGAAGCCCGATAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099848 Nonsense 914 1169 2 5
ENSDART00000131630 Nonsense 914 1169 3 6
Genomic Location (Zv9):
Chromosome 2 (position 23028495)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22861419
GRCz11 2 22517070
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGATTGGGCAAACCCACTTCCACTGCGTCCAAATCTCCAGTTATCATAT[T/A]GAAAGAATTGATGCGCGATAAGAAACAGTTCCAGCTAAAGCTGCAGGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link