zgc:153512

Ensembl ID:
ENSDARG00000068916
ZFIN ID:
ZDB-GENE-060825-232
Description:
UPF0683 protein C7orf47 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q0P427]
Human Orthologue:
C7orf47
Human Description:
chromosome 7 open reading frame 47 [Source:HGNC Symbol;Acc:28320]
Mouse Orthologue:
2010007H12Rik
Mouse Description:
RIKEN cDNA 2010007H12 gene Gene [Source:MGI Symbol;Acc:MGI:1922853]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10267 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10267
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059872 Nonsense 48 251 2 6
Genomic Location (Zv9):
Chromosome 20 (position 54843887)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54810156
GRCz11 20 54520092
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACCTGTCTGTCTCTCTCACCCCCGAGCGGCCAGCAGACAGACGCCGG[C/T]GAMAGGTTCGGTCCTGTGAAATATYTAAACTCACCGCAGTCAAGTTCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link