zgc:153031

Ensembl ID:
ENSDARG00000068876
ZFIN ID:
ZDB-GENE-060929-1190
Description:
hypothetical protein LOC557552 [Source:RefSeq peptide;Acc:NP_001038295]
Human Orthologues:
DHFR, DHFRL1
Human Descriptions:
dihydrofolate reductase [Source:HGNC Symbol;Acc:2861]
dihydrofolate reductase-like 1 [Source:HGNC Symbol;Acc:27309]
Mouse Orthologue:
Dhfr
Mouse Description:
dihydrofolate reductase Gene [Source:MGI Symbol;Acc:MGI:94890]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43069 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099764 Nonsense 68 195 3 6
Genomic Location (Zv9):
Chromosome 18 (position 14720017)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15165435
GRCz11 18 15133947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGGAAGAAGAATCTGATTGTCTGGGGCCGAATCTGCTGGTTCTCCTG[T/A]CCTGAGACGGTTTTTCCTTTGGCAAATTGCATAAATTTGGTATTGAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link