si:dkey-61p9.6

Ensembl ID:
ENSDARG00000068869
ZFIN IDs:
ZDB-GENE-030131-8896, ZDB-GENE-041210-234, ZDB-GENE-041210-377
Description:
hypothetical protein LOC558896 [Source:RefSeq peptide;Acc:NP_001038342]
Human Orthologues:
HSPA12A, HSPA12B
Human Descriptions:
heat shock 70kD protein 12B [Source:HGNC Symbol;Acc:16193]
heat shock 70kDa protein 12A [Source:HGNC Symbol;Acc:19022]
Mouse Orthologues:
Hspa12a, Hspa12b
Mouse Descriptions:
heat shock protein 12A Gene [Source:MGI Symbol;Acc:MGI:1920692]
heat shock protein 12B Gene [Source:MGI Symbol;Acc:MGI:1919880]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12979 Nonsense Available for shipment Available now
sa33515 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40343 Nonsense Mutation detected in F1 DNA During 2018
sa26366 Nonsense Mutation detected in F1 DNA During 2018
sa20322 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12979
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099739 Nonsense 202 571 3 4
ENSDART00000099750   None 571 None 4
Genomic Location (Zv9):
Chromosome 4 (position 61416397)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76203509
GRCz11 4 77678028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCTTGGAGCCTGAGGCTGCATCTATTTACTGCAAACAWCTGCYAAGT[G/T]AAGGCTAMATATCAGAGGAGGCCTGTCGAGACACACTGGAACAWAAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33515
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099739 Essential Splice Site 228 571 3 4
ENSDART00000099750   None 571 None 4
Genomic Location (Zv9):
Chromosome 4 (position 61416315)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76203591
GRCz11 4 77677946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACTGGAACAAAAACCTGGAACCCAGTATATGGTTGTGGATTGTGGAG[G/A]TACATCTCTAGCATTTCTCTTACATTGCTGTTTCATTTTGTACAGACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099739 Nonsense 387 571 4 4
ENSDART00000099750 Nonsense 387 571 4 4
Genomic Location (Zv9):
Chromosome 4 (position 61391467)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76228439
GRCz11 4 77653098
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGCTGAACATCGAGTACATGCTGTTAGTCGGAGGCTTTGCTGAATGT[A/T]AAATTCTGAAGAAGTTTCTGAAGGAGCGCTTTGATAAATGCAAGATAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26366
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099739 Nonsense 390 571 4 4
ENSDART00000099750 Nonsense 390 571 4 4
Genomic Location (Zv9):
Chromosome 4 (position 61391458)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76228448
GRCz11 4 77653089
KASP Assay ID:
2259-5264.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCGAGTACATGCTGTTAGTCGGAGGCTTTGCTGAATGTAAAATTCTG[A/T]AGAAGTTTCTGAAGGAGCGCTTTGATAAATGCAAGATAGTCTGCCCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20322
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099739 Nonsense 400 571 4 4
ENSDART00000099750 Nonsense 400 571 4 4
Genomic Location (Zv9):
Chromosome 4 (position 61391426)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76228480
GRCz11 4 77653057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGAATGTAAAATTCTGAAGAAGTTTCTGAAGGAGCGCTTTGATAAATG[C/A]AAGATAGTCTGCCCTGTTGAGCCCCAGGTAGTAATAATCAAAGGAGCGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Colorectal cancer: Genome-wide association analyses in East Asians identify new susceptibility loci for colorectal cancer. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link