si:dkey-98f17.5

Ensembl ID:
ENSDARG00000068863
ZFIN ID:
ZDB-GENE-060526-354
Description:
hypothetical protein LOC569123 [Source:RefSeq peptide;Acc:NP_001122220]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18796 Nonsense Available for shipment Available now
sa16443 Nonsense Available for shipment Available now
sa18486 Nonsense Available for shipment Available now
sa33544 Nonsense Available for shipment Available now
sa13955 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18796
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099741 Nonsense 32 449 1 12
ENSDART00000133167 Nonsense 32 440 1 12
ENSDART00000099741 Nonsense 32 449 1 12
ENSDART00000133167 Nonsense 32 440 1 12
Genomic Location (Zv9):
Chromosome 5 (position 13792896)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12090333
GRCz11 5 12590550
KASP Assay ID:
2259-5488.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTACAATTACAACACCGAGCGAAAGAATACTGAAAGAATGTCACACTT[T/A]ATATATCGACAGCGAGAACGGTAAACAAACAAATACCGCTAACACATTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16443
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099741 Nonsense 32 449 1 12
ENSDART00000133167 Nonsense 32 440 1 12
ENSDART00000099741 Nonsense 32 449 1 12
ENSDART00000133167 Nonsense 32 440 1 12
Genomic Location (Zv9):
Chromosome 5 (position 13792896)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12090333
GRCz11 5 12590550
KASP Assay ID:
2259-5488.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTACAATTACAACACCGAGYGAAAGAAWACTGAAAGAAKGTCACACTT[T/A]ATAWATCGACAGCGAGAACGGTAAACAAACAAATACCGCTAACACATTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18486
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099741 Nonsense 33 449 1 12
ENSDART00000133167 Nonsense 33 440 1 12
Genomic Location (Zv9):
Chromosome 5 (position 13792900)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12090337
GRCz11 5 12590554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAATTACAACACCGAGYGAAAGAAWACTGAAAGAAKGTCACACTTWATA[T/A]ATCGACAGCGAGAACGGTAAACAAACAAATACCGCTAACACATTCGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33544
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099741 Nonsense 77 449 3 12
ENSDART00000133167 Nonsense 77 440 3 12
Genomic Location (Zv9):
Chromosome 5 (position 13799575)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12097012
GRCz11 5 12597229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATTATTTAAAAAGGTAAAAAAGAAAATGTGTAACTATTTTTCAGGTA[T/A]GTGGAGGAGCACATACAGAAGACAGGTGTTGCCATAGAGACACAAGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13955
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099741 Essential Splice Site 125 449 4 12
ENSDART00000133167 Essential Splice Site 125 440 4 12
Genomic Location (Zv9):
Chromosome 5 (position 13805885)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12103322
GRCz11 5 12603539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAACGTTACACCTATATCCACATTTCAGACCTCTGCTGGAGTTCAAAG[G/A]TAGGAAATGATCATTTAGGAWTGATATTTGGTAWTGAAATGTAACTTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link