si:dkey-18a10.4

Ensembl ID:
ENSDARG00000068858
ZFIN IDs:
ZDB-GENE-080402-1, ZDB-GENE-091204-49
Description:
interleukin 2 receptor, gamma a [Source:RefSeq peptide;Acc:NP_001121743]
Human Orthologue:
IL2RG
Human Description:
interleukin 2 receptor, gamma [Source:HGNC Symbol;Acc:6010]
Mouse Orthologue:
Il2rg
Mouse Description:
interleukin 2 receptor, gamma chain Gene [Source:MGI Symbol;Acc:MGI:96551]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14683 Nonsense Available for shipment Available now
sa31788 Nonsense Available for shipment Available now
sa45415 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14683
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099732 Nonsense 45 362 2 8
ENSDART00000131873 Nonsense 45 374 2 8
Genomic Location (Zv9):
Chromosome 10 (position 34582241)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33610099
GRCz11 10 33553959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAATCTGGACTATGTGAACTGCACATGGAGCGAACATCAGTACAATTA[C/A]AGTCTCAAGGGCGGGTATGTATTAMTGAAACAAGAAAGCATTTTNNTRAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31788
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099732 Nonsense 106 362 3 8
ENSDART00000131873 Nonsense 106 374 3 8
Genomic Location (Zv9):
Chromosome 10 (position 34581983)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33609841
GRCz11 10 33553701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGTACCGTGACGATGGCAGTTTGGTGACGGAACAGGAACATATGCTG[A/T]AAGAATATGGTATGAGAAGCCATTCGTTTCTTGCTTTCTCAAGATTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099732 Nonsense 336 362 8 8
ENSDART00000131873 Nonsense 348 374 8 8
Genomic Location (Zv9):
Chromosome 10 (position 34572694)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33600552
GRCz11 10 33544412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCCTCTCCAACCCAACAGACGTATCATCTGATTACCAAAGCATGCAC[A/T]GATATTCATCAGCCTCAACAATACCCGGATCTGCTGAACCCCTGCAAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link